Methylation Specific PCRs and RT-PCR DNAs were treated with bisulfite as indicated by the supplier, Methylation specific PCRs (M-PCR, U-PCR) and quantifying PCR (PCR-Q) were performed after a first amplification (PCR1) ,
20 and 19 cycles, respectively. The following primers were used: PCR-1 GTTTTGGGTTTTGGGAGTTGAGAG and ACCACCCACTTCTCCTATAAAA (874 bp; M-PCR GGGGTTATTATGGGTAGAGGATATC and ACATACTAAACGAATTCCGAACGACTC (109 bp); U-PCR GGGTTATTATGGGTAGAGGATATT and ACATACTAAACAAATTCCAAACAACTCTC (112 bp); and PCR Q TAAATAGTGGGTGAGTTATGAAGATGT and TACACCAAACCCTAACTAAAAAACC (285 bp) Extracted RNAs were reversed transcripted and amplified as previously described [12]. For TP73 RT-PCR assays, the following primers were used: TAp73 ex2-6 CACCACGTTTGAGCACCTCT and AGATTATTGCCTTCCACGCG (630 bp); TP73 ex7-10 GACGGAATTCACCACCATCCT and CCAGGCTCTCTTTCAGCTTC (389 bp); and ?Np73, pp.3-6 ,
International Myeloma Working Group molecular classification of multiple myeloma: spotlight review, Leukemia, vol.91, issue.12, pp.2210-2221, 2009. ,
DOI : 10.1016/j.beha.2007.08.004
Long-Term Analysis of the IFM 99 Trials for Myeloma: Cytogenetic Abnormalities [t(4;14), del(17p), 1q gains] Play a Major Role in Defining Long-Term Survival, Journal of Clinical Oncology, vol.30, issue.16, pp.1949-1952, 2012. ,
DOI : 10.1200/JCO.2011.36.5726
Mutations in TP53 are exclusively associated with del(17p) in multiple myeloma, Haematologica, vol.95, issue.11, pp.95-1973, 2010. ,
DOI : 10.3324/haematol.2010.023697
Clonal selection and double-hit events involving tumor suppressor genes underlie relapse in myeloma, Blood, vol.128, pp.1735-1744, 2016. ,
A Next-Generation Sequencing Strategy for Evaluating the Most Common Genetic Abnormalities in Multiple Myeloma, J. Mol. Diagn. 2017, vol.19, pp.99-106 ,
Mutational landscape reflects the biological continuum of plasma cell dyscrasias, Blood Cancer J, vol.2017, issue.7 ,
A high-risk signature for patients with multiple myeloma established from the molecular classification of human myeloma cell lines, Haematologica, vol.96, pp.574-582, 2011. ,
URL : https://hal.archives-ouvertes.fr/inserm-00550232
p53 dysregulation in B-cell malignancies: More than a single gene in the pathway to hell, Blood Rev, vol.2017, issue.31, pp.251-259 ,
URL : https://hal.archives-ouvertes.fr/inserm-01493742
Targeting mutant p53 for efficient cancer therapy, Nature Reviews Cancer, vol.44, 2017. ,
DOI : 10.1093/nar/gkw010
RITA (Reactivating p53 and Inducing Tumor Apoptosis) is efficient against TP53 abnormal myeloma cells independently of the p53 pathway, BMC Cancer, vol.19, issue.6, p.437, 2014. ,
DOI : 10.1038/cdd.2011.182
PRIMA-1Met induces myeloma cell death independent of p53 by impairing the GSH/ROS balance, Blood, vol.124, issue.10, pp.1626-1636, 2014. ,
DOI : 10.1182/blood-2014-01-548800
The TP73 complex network: Ready for clinical translation in cancer? Genes Chromosomes Cancer, pp.989-1006, 2013. ,
Kawiak, A. p73 tumor suppressor protein: A close relative of p53 not only in structure but also in anti-cancer approach? Cell Cycle, pp.720-728, 2010. ,
Loss of p73 gene expression in leukemias/lymphomas due to hypermethylation, Blood, vol.94, pp.1113-1120, 1999. ,
Role of p53 family members p73 and p63 in human hematological malignancies, Leukemia & Lymphoma, vol.15, issue.11, pp.2116-2129, 2012. ,
DOI : 10.1016/j.leukres.2003.08.008
Targeting p73 in cancer, Cancer Letters, vol.332, issue.2, pp.229-236 ,
DOI : 10.1016/j.canlet.2011.07.030
PRIMA-1 targets the vulnerability of multiple myeloma of deregulated protein homeostasis through the perturbation of ER stress via p73 demethylation, Oncotarget, vol.7, issue.38, pp.61806-61819, 2016. ,
DOI : 10.18632/oncotarget.11241
Cell Death via DR5, but not DR4, Is Regulated by p53 in Myeloma Cells, Cancer Research, vol.72, issue.17, pp.4562-4573, 2012. ,
DOI : 10.1158/0008-5472.CAN-12-0487
A balancing act: orchestrating amino-truncated and full-length p73 variants as decisive factors in cancer progression, Oncogene, vol.30, issue.33, pp.4287-4299, 2015. ,
DOI : 10.1038/onc.2010.635
Bendamustine and melphalan kill myeloma cells similarly through reactive oxygen species production and activation of the p53 pathway and do not overcome resistance to each other, Leukemia & Lymphoma, vol.296, issue.9, pp.2165-2173, 2014. ,
DOI : 10.1016/j.bbmt.2013.02.013
PRIMA-1Met/APR-246 Displays High Antitumor Activity in Multiple Myeloma By Induction of p73 and Noxa, Molecular Cancer Therapeutics, vol.12, issue.11, pp.2331-2341, 2013. ,
DOI : 10.1158/1535-7163.MCT-12-1166
p63 and p73: Roles in development and tumor formation, Mol. Cancer Res, vol.2, pp.371-386, 2004. ,
p53 and E2f: partners in life and death, Nature Reviews Cancer, vol.416, issue.10, pp.738-748, 2009. ,
DOI : 10.1038/msb.2008.65
Regulation of p73 activity by post-translational modifications, Cell Death & Disease, vol.1, issue.3, p.285 ,
DOI : 10.1038/cddis.2010.85
HDAC inhibitors trigger apoptosis in HPV-positive cells by inducing the E2F???p73 pathway, Oncogene, vol.23, issue.28, pp.4807-4817, 2004. ,
DOI : 10.1074/jbc.M005600200