Uncovering Nuclear Pore Complexity with Innovation, Cell, vol.152, issue.6, pp.1218-1221, 2013. ,
DOI : 10.1016/j.cell.2013.02.042
URL : https://doi.org/10.1016/j.cell.2013.02.042
HTSeq--a Python framework to work with high-throughput sequencing data, Bioinformatics, vol.31, issue.2, pp.166-169, 2015. ,
DOI : 10.1093/bioinformatics/btu638
URL : https://academic.oup.com/bioinformatics/article-pdf/31/2/166/7000027/btu638.pdf
Meristem-specific expression of epigenetic regulators safeguards transposon silencing in Arabidopsis, EMBO reports, vol.15, issue.4, pp.446-452, 2014. ,
DOI : 10.1002/embr.201337915
Procedure for whole mount fluorescence in situ hybridization of interphase nuclei on Arabidopsis thaliana, The Plant Journal, vol.6, issue.1, pp.123-131, 1994. ,
DOI : 10.1046/j.1365-313X.1994.6010123.x
Genome Architecture: Domain Organization of Interphase Chromosomes, Cell, vol.152, issue.6, pp.1270-1284, 2013. ,
DOI : 10.1016/j.cell.2013.02.001
Light signaling controls nuclear architecture reorganization during seedling establishment, Proc. Natl. Acad. Sci. USA, pp.2836-2844, 2015. ,
DOI : 10.1371/journal.pgen.1003437
URL : http://www.pnas.org/content/112/21/E2836.full.pdf
Evidence for karyoplasmic homeostasis during endoreduplication and a ploidy-dependent increase in gene transcription during tomato fruit growth, Development, vol.139, issue.20, pp.3817-3826, 2012. ,
DOI : 10.1242/dev.084053
URL : https://hal.archives-ouvertes.fr/hal-00855581
Telomere anchoring at the nuclear periphery requires the budding yeast Sad1-UNC-84 domain protein Mps3, The Journal of Cell Biology, vol.134, issue.5, pp.845-854, 2007. ,
DOI : 10.1016/j.tcb.2005.12.006
URL : http://jcb.rupress.org/content/jcb/179/5/845.full.pdf
MPS3 mediates meiotic bouquet formation in Saccharomyces cerevisiae, Proc. Natl. Acad. Sci. USA, pp.8863-8868, 2007. ,
DOI : 10.1083/jcb.200505020
URL : http://www.pnas.org/content/104/21/8863.full.pdf
Coupling of the nucleus and cytoplasm, The Journal of Cell Biology, vol.115, issue.1, pp.41-53, 2006. ,
DOI : 10.1242/jcs.01642
Differences in the Localization and Morphology of Chromosomes in the Human Nucleus, The Journal of Cell Biology, vol.100, issue.6, pp.1119-1131, 1999. ,
DOI : 10.1023/A:1018438729203
Non-specific interactions are sufficient to explain the position of heterochromatic chromocenters and nucleoli in interphase nuclei, Nucleic Acids Research, vol.37, issue.11, pp.3558-3568, 2009. ,
DOI : 10.1093/nar/gkp219
LITTLE NUCLEI Genes Affecting Nuclear Morphology in Arabidopsis thaliana, THE PLANT CELL ONLINE, vol.19, issue.9, pp.2793-2803, 2007. ,
DOI : 10.1105/tpc.107.053231
URL : http://www.plantcell.org/content/plantcell/19/9/2793.full.pdf
Centromere Positioning and Dynamics in Living Arabidopsis Plants, Molecular Biology of the Cell, vol.16, issue.12, pp.5710-5718, 2005. ,
DOI : 10.1091/mbc.E05-08-0706
URL : http://www.molbiolcell.org/content/16/12/5710.full.pdf
Telomeres and centromeres have interchangeable roles in promoting meiotic spindle formation, The Journal of Cell Biology, vol.160, issue.4, pp.415-428, 2015. ,
DOI : 10.1083/jcb.201207168
URL : http://jcb.rupress.org/content/jcb/208/4/415.full.pdf
Interphase chromosomes in Arabidopsis are organized as well defined chromocenters from which euchromatin loops emanate, Proc. Natl. Acad. Sci. USA 99, pp.14584-14589, 2002. ,
DOI : 10.1016/S0962-8924(97)01034-9
URL : http://www.pnas.org/content/99/22/14584.full.pdf
Cloning and characterization of ribosomal RNA genes from wheat and barley, Nucleic Acids Research, vol.7, issue.7, pp.1869-1885, 1979. ,
DOI : 10.1093/nar/7.7.1869
URL : https://academic.oup.com/nar/article-pdf/7/7/1869/7056022/7-7-1869.pdf
The role of chromatin structure in cell migration, Trends in Cell Biology, vol.21, issue.1, pp.6-11, 2011. ,
DOI : 10.1016/j.tcb.2010.09.002
The Novel Nuclear Envelope Protein KAKU4 Modulates Nuclear Morphology in Arabidopsis, The Plant Cell, vol.26, issue.5, pp.2143-2155, 2014. ,
DOI : 10.1105/tpc.113.122168
The plant nuclear envelope in focus: Figure 1, Biochemical Society Transactions, vol.38, issue.1, pp.307-311, 2010. ,
DOI : 10.1042/BST0380307
URL : http://www.biochemsoctrans.org/content/ppbiost/38/1/307.full.pdf
The nuclear envelope-structure and protein interactions, Ann. Plant Rev, vol.46, pp.19-56, 2013. ,
DOI : 10.1002/9781118472507.ch2
Characterization of SUN-domain proteins at the higher plant nuclear envelope, The Plant Journal, vol.136, issue.1, pp.134-144, 2010. ,
DOI : 10.4161/cc.3.12.1316
Characterization of two distinct subfamilies of SUN-domain proteins in Arabidopsis and their interactions with the novel KASH-domain protein AtTIK, Journal of Experimental Botany, vol.65, issue.22, pp.6499-6512, 2014. ,
DOI : 10.1093/jxb/eru368
Hi-C Analysis in Arabidopsis Identifies the KNOT, a Structure with Similarities to the flamenco Locus of Drosophila, Molecular Cell, vol.55, issue.5, pp.678-693, 2014. ,
DOI : 10.1016/j.molcel.2014.07.009
Interaction between the inner nuclear membrane lamin B receptor and the heterochromatic methyl binding protein, MeCP2, Experimental Cell Research, vol.315, issue.11, pp.1895-1903, 2009. ,
DOI : 10.1016/j.yexcr.2009.01.019
Domain organization of human chromosomes revealed by mapping of nuclear lamina interactions, Nature, vol.38, issue.7197, pp.948-951, 2008. ,
DOI : 10.1091/mbc.8.12.2407
The GCP3-Interacting Proteins GIP1 and GIP2 Are Required for ??-Tubulin Complex Protein Localization, Spindle Integrity, and Chromosomal Stability, The Plant Cell, vol.24, issue.3, pp.1171-1187, 2012. ,
DOI : 10.1105/tpc.111.094904
URL : https://hal.archives-ouvertes.fr/hal-00855567
Transcript profiling of the hypomethylated hog1 mutant of Arabidopsis, Plant Molecular Biology, vol.39, issue.1, pp.571-586, 2007. ,
DOI : 10.1371/journal.pbio.0000067
Positioning of Nuclei in Arabidopsis Root Hairs, The Plant Cell, vol.14, issue.11, pp.2941-2955, 2002. ,
DOI : 10.1105/tpc.005892
TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions, Genome Biology, vol.14, issue.4, p.36, 2013. ,
DOI : 10.1186/gb-2009-10-3-r25
How mechanical stress controls microtubule behavior and morphogenesis in plants: history, experiments and revisited theories, The Plant Journal, vol.26, issue.Pt 4, pp.324-338, 2013. ,
DOI : 10.1007/s00344-006-0029-2
URL : http://onlinelibrary.wiley.com/doi/10.1111/tpj.12188/pdf
FactoMineR: an R package for multivariate analysis, J. Stat. Softw, vol.25, pp.1-18, 2008. ,
Nuclear Size Is Regulated by Importin ?? and Ntf2 in Xenopus, Cell, vol.143, issue.2, pp.288-298, 2010. ,
DOI : 10.1016/j.cell.2010.09.012
URL : https://doi.org/10.1016/j.cell.2010.09.012
Chromatin in 3D: progress and prospects for plants, Genome Biology, vol.113, issue.1, 2015. ,
DOI : 10.1007/s00412-004-0316-2
URL : https://genomebiology.biomedcentral.com/track/pdf/10.1186/s13059-015-0738-6?site=genomebiology.biomedcentral.com
A highly repeated DNA sequence in Arabidopsis thaliana, MGG Molecular & General Genetics, vol.11, issue.3, pp.417-423, 1986. ,
DOI : 10.1007/BF00331018
Chromatin states and nuclear organization in development ??? a view from the nuclear lamina, Genome Biology, vol.45, issue.1, pp.174-189, 2015. ,
DOI : 10.1016/j.ymeth.2008.06.013
LINC complexes in health and disease, Nucleus, vol.1, issue.1, pp.40-52, 2010. ,
DOI : 10.4161/nucl.1.1.10530
Relationship between Endopolyploidy and Cell Size in Epidermal Tissue of Arabidopsis, THE PLANT CELL ONLINE, vol.5, issue.11, pp.1661-1668, 1993. ,
DOI : 10.1105/tpc.5.11.1661
Chromatin immunoprecipitation reveals that the 180-bp satellite repeat is the key functional DNA element of arabidopsis thaliana centromeres, Genetics, vol.163, pp.1221-1225, 2003. ,
Nuclear size control in fission yeast, The Journal of Cell Biology, vol.13, issue.4, pp.593-600, 2007. ,
DOI : 10.1038/nrg1747
URL : http://jcb.rupress.org/content/jcb/179/4/593.full.pdf
Dynamics of Arabidopsis SUN proteins during mitosis and their involvement in nuclear shaping, The Plant Journal, vol.20, issue.4, pp.629-641, 2011. ,
DOI : 10.1105/tpc.108.059220
Points, Pixels, and Gray Levels: Digitizing Image Data, Handbook of Biological Confocal Microscopy, pp.59-79, 2006. ,
DOI : 10.1007/978-0-387-45524-2_4
Characterization of the Drosophila melanogaster genome at the nuclear lamina, Nature Genetics, vol.108, issue.9, pp.1005-1014, 2006. ,
DOI : 10.1038/sj.embor.7400441
NucleusJ: an ImageJ plugin for quantifying 3D images of interphase nuclei, Bioinformatics, vol.31, issue.7, pp.1144-1146, 2015. ,
DOI : 10.1093/bioinformatics/btu774
URL : https://academic.oup.com/bioinformatics/article-pdf/31/7/1144/17124501/btu774.pdf
Exploring the evolution of the proteins of the plant nuclear envelope, Nucleus, vol.8, issue.1, 2016. ,
DOI : 10.1080/19491034.2014.1003512
Two means of transcriptional reactivation within heterochromatin, The Plant Journal, vol.10, issue.4, pp.743-749, 2003. ,
DOI : 10.1046/j.1365-313X.2003.01667.x
Molecular mechanisms controlling pavement cell shape in Arabidopsis leaves, Plant Cell Reports, vol.272, issue.8, pp.1147-1157, 2009. ,
DOI : 10.1007/s00299-009-0729-8
Clustering heterochromatin: Sir3 promotes telomere clustering independently of silencing in yeast, The Journal of Cell Biology, vol.149, issue.3, pp.417-431, 2011. ,
DOI : 10.1083/jcb.201008007.dv
URL : https://hal.archives-ouvertes.fr/hal-00631367
New algorithms for euclidean distance transformation of an n-dimensional digitized picture with applications. Pattern Recogn, pp.1551-1565, 1994. ,
Interphase chromatin organisation in Arabidopsis nuclei: constraints versus randomness, Chromosoma, vol.166, issue.Pt 4, pp.369-387, 2012. ,
DOI : 10.1083/jcb.200404107
Mutant nuclear lamin A leads to progressive alterations of epigenetic control in premature aging, Proc. Natl. Acad. Sci. USA 103, pp.8703-8708, 2006. ,
DOI : 10.1177/002215549704501201
Structure and Function of Centromeric and Pericentromeric Heterochromatin in Arabidopsis thaliana, Frontiers in Plant Science, vol.111, pp.1049-1057, 2015. ,
DOI : 10.1105/tpc.107.057083
The Late Flowering Phenotype of fwa Mutants Is Caused by Gain-of-Function Epigenetic Alleles of a Homeodomain Gene, Molecular Cell, vol.6, issue.4, pp.791-802, 2000. ,
DOI : 10.1016/S1097-2765(05)00090-0
Endogenous Targets of Transcriptional Gene Silencing in Arabidopsis, THE PLANT CELL ONLINE, vol.12, issue.7, pp.1165-1178, 2000. ,
DOI : 10.1105/tpc.12.7.1165
???Big it up???: endoreduplication and cell-size control in plants, Current Opinion in Plant Biology, vol.6, issue.6, pp.544-553, 2003. ,
DOI : 10.1016/j.pbi.2003.09.009
RHL1 is an essential component of the plant DNA topoisomerase VI complex and is required for ploidy-dependent cell growth, Proc. Natl. Acad. Sci. USA, pp.18736-18741, 2005. ,
DOI : 10.1093/nar/25.15.3135
Involvement of the nuclear pore complex in morphology of the plant nucleus, Nucleus, vol.2, issue.3, pp.168-172, 2011. ,
DOI : 10.1073/pnas.0402943101
The International Nucleome Consortium, Nucleus, vol.6, issue.2, pp.89-92, 2015. ,
DOI : 10.1126/science.1237150
URL : http://www.tandfonline.com/doi/pdf/10.1080/19491034.2015.1022703?needAccess=true
Large-scale dissociation and sequential reassembly of pericentric heterochromatin in dedifferentiated Arabidopsis cells, Journal of Cell Science, vol.120, issue.7, pp.1200-1208, 2007. ,
DOI : 10.1242/jcs.000026
Light-regulated large-scale reorganization of chromatin during the floral transition in Arabidopsis, The Plant Journal, vol.27, issue.Suppl., pp.848-857, 2007. ,
DOI : 10.1111/j.1365-313X.2007.03093.x
PHYTOCHROME B and HISTONE DEACETYLASE 6 Control Light-Induced Chromatin Compaction in Arabidopsis thaliana, PLoS Genetics, vol.112, issue.5, 2009. ,
DOI : 10.1371/journal.pgen.1000638.s010
URL : http://doi.org/10.1371/journal.pgen.1000638
R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing Version 3, 2015. ,
Identification and distribution of seven classes of middle-repetitive DNA in the Arabidopsis thaliana genome, Nucleic Acids Research, vol.24, issue.15, pp.3017-3022, 1996. ,
DOI : 10.1093/nar/24.15.3017
Endoreduplication and development: rule without dividing?, Current Opinion in Plant Biology, vol.1, issue.6, pp.498-503, 1998. ,
DOI : 10.1016/S1369-5266(98)80042-3
Hypomethylation and hypermethylation of the tandem repetitive 5S??rRNA genes in Arabidopsis, The Plant Journal, vol.95, issue.2, pp.299-309, 2008. ,
DOI : 10.1186/gb-2004-5-12-249
Seed maturation in Arabidopsis thaliana is characterized by nuclear size reduction and increased chromatin condensation, Proc. Natl. Acad. Sci. USA, pp.20219-20224, 2011. ,
DOI : 10.1105/tpc.111.084103
Arabidopsis CROWDED NUCLEI (CRWN) proteins are required for nuclear size control and heterochromatin organization, BMC Plant Biology, vol.13, issue.1, 0200. ,
DOI : 10.1007/BF02672073
URL : https://bmcplantbiol.biomedcentral.com/track/pdf/10.1186/1471-2229-13-200?site=bmcplantbiol.biomedcentral.com
Sizing up the nucleus: nuclear shape, size and nuclear-envelope assembly, Journal of Cell Science, vol.122, issue.10, pp.1477-1486, 2009. ,
DOI : 10.1242/jcs.037333
URL : http://jcs.biologists.org/content/joces/122/10/1477.full.pdf
Dictyostelium Sun-1 Connects the Centrosome to Chromatin and Ensures Genome Stability, Traffic, vol.96, issue.5, pp.708-724, 2008. ,
DOI : 10.1083/jcb.128.5.819
URL : http://onlinelibrary.wiley.com/doi/10.1111/j.1600-0854.2008.00721.x/pdf
The Histone Variant H2A.W Defines Heterochromatin and Promotes Chromatin Condensation in Arabidopsis, Cell, vol.158, issue.1, pp.98-109, 2014. ,
DOI : 10.1016/j.cell.2014.06.006
Efficient plant male fertility depends on vegetative nuclear movement mediated by two families of plant outer nuclear membrane proteins, Proc. Natl. Acad. Sci. USA, pp.11900-11905, 2014. ,
DOI : 10.1105/tpc.2.8.755
Novel plant SUN???KASH bridges are involved in RanGAP anchoring and nuclear shape determination, The Journal of Cell Biology, vol.343, issue.2, pp.203-211, 2012. ,
DOI : 10.1105/tpc.108.059220
URL : http://jcb.rupress.org/content/jcb/196/2/203.full.pdf
The plant nuclear envelope as a multifunctional platform LINCed by SUN and KASH, Journal of Experimental Botany, vol.66, issue.6, pp.1649-1659, 2015. ,
DOI : 10.1093/jxb/erv082
Plant nuclear shape is independently determined by the SUN-WIP-WIT2-myosin XI-i complex and CRWN1, Nucleus, vol.6, issue.2, pp.144-153, 2015. ,
DOI : 10.1046/j.1365-313x.1998.00343.x
URL : http://www.tandfonline.com/doi/pdf/10.1080/19491034.2014.1003512?needAccess=true
130: doi:10.1242/jcs.194712: Supplementary information Journal of Cell Science ? Supplementary information Table S5: Primers used in this study Purpose Gene FORWARD (F) and REVERSE (R) PRIMERS (5' to 3 ,
TAGCATCTGAATTTCATAACCAATCTCGATACAC Genotyping of wip2-1 (SALK_052226) At5g56210 CT286_wip2, Genotyping of wit1-1 (GABI-Kat 470E06) At5g11390 CT383_Wit1: TTCTTCCATGTAGACAACATCCTG CT384_Wit1: CACCATGGAAACAGAAACGGAACATGATAGA GK_o8409: ATATTGACCATCATACTCATTGC Genotyping of ATTTTGCCGATTTCGGAAC Genotyping of wip1-1 (SAIL_390_A08) At4g26455 CT425_SAIL390_A08_Wip1-1_LB:: TAGCAGTATCATGACCCAGCC CT140_SALK126070_RP: GTCAGGGAGTCTGAGTTTCCC LBb1.3: ATTTTGCCGATTTCGGAAC Genotyping of SALK_025347) At1g67230 CT_Linc1_N525347_LP_11: GCAACTTTGTCAAAGCAGAGG CT_Linc1_N525347_RP_12: AGTTTCCAATGCCTTCTCCTC LBb1, pp.2-3, 23383. ,