We first addressed the contribution of PLD to the maintenance of muscle cell functionality by studying the consequences of PLD inhibition in fully differentiated L6 myotubes. Preventing PA formation by PLD can be achieved by the addition of a primary alcohol that reroutes PLD activity to the production of phosphatidylalcohol. Myotubes were treated for 48 hrs with either 0.5% 1-butanol, or 0.5% 2-butanol that is not recognized by PLD and serves as a negative control. Immunofluorescent labelling of myosin heavy chain (MHC) was subsequently used to measure myotube area. 1-butanol induced a marked decrease of myotube area, whereas 2-butanol had no significant effects (Figure  1A). Creatine kinase (CK) activity of treated myotubes was also determined to evaluate muscle cell functionality. 1-butanol had a stronger negative effect on myotube CK activity than 2-butanol (Figure  1B). In addition, MHC content of myotubes was found more markedly lowered by 1-butanol than by 2-butanol (Figure  1C). These results suggest that inhibiting PLD activity induces an atrophy of myotubes, that is reflected by a decreased cell size and a loss of muscle proteins. Because concerns have been raised about the effect of primary alcohols as an index of PLD involvement in cell responses 26 27 , we assessed the effects of small molecule inhibitors of PLD. Treatment of myotubes by FIPI, an inhibitor of both PLD isoforms 28 , resulted in a marked atrophy, thereby confirming the involvement of PLD inhibition in the above observations (Figure  2A,B). We then used PLD isoform-specific inhibitors 29 , and observed that PLD1 inhibition affected myotube chatacteristics, whereas PLD2 inhibition had no significant effect (Figure  2A,B). Finally, the respective role of PLD isoforms was further assessed by using PLD1- or PLD2-siRNA. This approach confirmed that PLD1 depletion was more efficient than PLD2 depletion to decrease myotube area and CK activity (Figure  3A,B). Conversely, we found adenovirus-mediated overexpression of PLD1 to significantly increase myotube area and CK activity as compared with control cells, whereas PLD2 overexpression had no significant effect (Figure  3C,D). These observations confirmed that PLD1 positively regulates muscle cells. To verify that enzymatic activity is required for PLD1 trophic effects, we treated PLD1-overexpressing myotubes with PLD inhibitors. As expected, the dual PLD inhibitor FIPI and the PLD1-specific inhibitor both suppressed the hypertrophy induced by PLD1 overexpression, whereas the PLD2-specific inhibitor had no sigificant effect (Figure  3E).

Next, we assessed the in vivo relevance of these observations. We injected a PLD1-encoding adenovirus in the right gastrocnemius of mice, the left gastrocnemius being injected with an adenovirus encoding GFP as a control. Muscles were dissected 10 days following injection, and PLD1 overexpression was verified (Figure  4A). Measurement of myofibre cross sectional area (CSA) demonstrated a significant increase in myofibre size in PLD1-injected muscles as compared with GFP-injected ones, as shown by a shift of the CSA distribution curve towards higher values (Figure  4B,C). Taking advantage of the HA-tag fused to our PLD1-expressing construct, we then compared the respective CSA of myofibres expressing or not the fusion protein, in sections of PLD1-injected muscles. Immunofluorescent labeling of recombinant HA-tagged PLD1 (Additional file 1) followed by CSA measurement confirmed a significant increase (16%) in the size of PLD1-expressing fibres (Figure  4D).

Muscle cell atrophy can be induced in vivo and in vitro by synthetic glucocorticoids such as dexamethasone 31 32 . We investigated the effects of PLD isoform overexpression in dexamethasone-treated myotubes. As expected, dexamethasone induced a marked atrophy of myotubes, as evidenced by reduced myotube size and CK activity. Interestingly, this atrophic effect was suppressed in PLD1-overexpressing cells, but not affected by PLD2 overexpression (Figure  5A,B). Moreover, inhibition of PLD activity by FIPI restored the atrophic effect of dexamethasone in PLD1-overexpressing myotubes (Figure  5C). Next, we mimicked PLD activation by adding exogenous PA to dexamethasone-treated cells. We found PA addition able to partially restore both myotube size and CK activity (Figure  5D,E). We then used another agent able to induce atrophy of muscle cells, the pro-inflammatory cytokine TNFα 33 34 . We observed that the addition of exogenous PA suppressed the negative effects of TNFα on both myotube size and CK activity (Figure  6A,B). Taken together, these data demonstrate that both PLD1 overexpression and exogenous PA supply had an anti-atrophic effect, in the presence of two different atrophy-inducing treatments.

Muscle atrophy is closely related to changes in the expression of a set of genes called atrogenes 35 , that include the E3 ubiquitin ligases Murf1 and Atrogin-1 involved in the proteasome-dependent muscle protein catabolism 36 . Cell proteolytic systems are under the positive control of Foxo transcription factors, in particular Foxo3 37 . To get insight into PLD action on muscle proteolytic machinery, we assessed the expression of Murf1, Atrogin-1 and Foxo3 transcripts in L6 myotubes subjected to PLD modulation. As shown in Figure  7A, we observed a strong inhibition of the basal expression of the three genes specifically in cells overexpressing PLD1, but not in PLD2-overexpressing cells. Furthermore, the siRNA-mediated depletion of PLD1 induced a marked increase in Murf1 and Foxo3 expression, whereas the down-regulation of PLD2 had no significant effect (Figure  7B). From here we deduced that PLD1 hypertrophic effects may be related to its capacity to down-regulate the basal expression of genes involved in proteolysis. To confirm the role of PLD in the negative control of atrogene expression, we then treated myotubes with the PLD inhibitor FIPI. We observed that PLD inhibition markedly increased atrogene mRNA levels (Figure  7C). We next evaluated the effects of a PA treatment on atrogene expression induced by dexamethasone. In agreement with its pro-atrophic properties, we found dexamethasone to induce a robust expression of the atrogenes. However, these effects were significantly lowered by the addition of exogenous PA (Figure  7D). On the whole, these observations show that PLD and PA are able to down-regulate atrogene expression, both in basal conditions and in dexamethasone-induced atrophy.

PLD being an upstream regulator of the mTOR pathway, we next assessed whether the activity of mTOR is required for the hypertrophic effect of PLD1 overexpression. To this end, we used the PP242 inhibitor, which blocks both mTORC1 and mTORC2 complexes 38 . In line with published work showing that mTORC1 is inhibited in muscle atrophy, we observed a marked reduction of myotube size and CK activity in myotubes treated by PP242 alone (Figure  8A,B). Moreover, we found the PP242 treatment to totally abolish the hypertrophic effects induced in myotubes by PLD1 overexpression, supporting the view that PLD1 acted through mTOR stimulation (Figure  8A,B).

We further explored the influence of PLD on mTOR signaling by evaluating the consequences of PLD modulation on the phosphorylation of S6K1 and Akt, which are downstream effectors of, respectively, mTORC1 and mTORC2. Whereas PLD1 overexpression increased S6K1 phosphorylation, siRNA-mediated PLD depletion had the opposite effect. In the same line of observations, we found the PLD inhibitors able to decrease S6K1 phosphorylation, FIPI and the PLD1-specific inhibitor being more efficient than the PLD2-specific inhibitor (Figure  9A). Moreover, siRNA-mediated PLD1 depletion or PLD1 inhibition decreased Akt phosphorylation levels, whereas PLD1 overexpression had the opposite effect (Figure  9B). It is worth mentionning that PLD2 overexpression induced moderate, non significant, effects on S6K1 or Akt activation (Figure  9A,B). Together, these results suggest that, in L6 myotubes, PLD is involved in both mTORC1 and mTORC2 activation, mainly through its PLD1 isoform. We also observed that treating myotubes by dexamethasone or 1-butanol induced an inhibition of both S6K1 and Akt phosphorylation, therefore confirming that in atrophy-promoting conditions mTOR signaling is inhibited (Additional file 2). Furthermore, we verified that siRNA-mediated depletion of Rictor (and thus disruption of the mTORC2 complex) decreased the phosphorylation of Akt, confirming that Akt is a substrate for mTORC2 in L6 myotubes (Additional file 2).

ECL detection reagent was from Pierce Thermo Fisher Scientific (Brebières, France). Bradford protein assay was from Bio-Rad (Marnes-La-Coquette, France). Arginine-vasopressin (AVP), compound PP242, 5-Fluoro-2-indolyldeschlorohalopemide (FIPI), dioctanoyl-PA, dexamethasone and myosin heavy chain were purchased from Sigma-Aldrich (L’Isle-d’abeau, France). Selective inhibitors of PLD1 (CAY10593) and PLD2 (CAY10594) were supplied by Cayman Chemical Co. (Ann Arbor, USA). Recombinant rat TNFα was from Immunotools (Friesoythe, Germany). Anti-phospho-Thr389/Thr412-S6K1 antibody, anti-S6K1 antibody, anti-phospho-Ser473-Akt antibody and anti-Akt antibody (which recognize all three Akt isoforms) were from Cell Signaling Technology (Danvers, USA). Anti-sarcomeric myosin heavy chain MF-20 antibody was from Developmental Studies Hybridoma Bank, University of Iowa (Iowa City, USA). Anti-HA tag antibody was from Covence (Rueil-Malmaison, France). Anti-laminin antibody was from Sigma-Aldrich. HRP-conjugated anti-mouse- and anti-rabbit-IgG antibodies were from Jackson Immunoresearch Laboratories (Soham, UK).

L6 myoblasts were maintained in Dulbecco’s modified Eagle’s medium (DMEM) with 4.5 g/l glucose, supplemented with 10% (v/v) fetal bovine serum at 37°C and 5% CO₂. To induce differentiation, cells were seeded at a density of 5.10⁵ cells per well in 6-well plates, grown to confluence, shifted to DMEM supplemented with 1% fetal bovine serum and 10^-7 M AVP, and cultured for 5 days. The obtained myotubes were then treated with the appropriate agent for 2 days, or with 15 ng/mL recombinant rat TNFα for 3 days to induce atrophy. Dioctanoyl-PA stock solution was obtained by solubilizing the compound in Tris pH 8 buffer at a concentration of 50 mM.

The siRNA used were targeted to rat PLD1 sequence 5’-AAGTTAAGAGGAAATTCAAGC- 3’, rat PLD2 sequence 5’-GACACAAAGTCTTGATGAG-3’, rat PLD1/2 sequence 5′-GAAATGGAGCCATCCCTCA-3′. Control siRNA was purchased from Eurogentec (Angers, France). siRNAs targeting Rictor and Raptor have been described in 22 .

The transfection of siRNAs was performed using Hiperfect reagent (Qiagen, Courtaboeuf, France) with 50 nM siRNA for 48 hours; the medium was changed after 24 hours of transfection.

Recombinant adenoviral constructs carrying the cDNA of interest (hHA-PLD1b, hHA-PLD2 or GFP) were generated as previously described 45 . Infections of myotubes were performed at a multiplicity of infection of 100 (with regard to initial myoblast number) in complete medium. After 24 hours of incubation in the presence of viral particles, the medium was changed and cells were cultured for additional 24 hours. Under these conditions, most of the cells were positive for GFP when infected with a GFP expressing adenovirus.

Differentiated myotubes were fixed with 3.7% formaldehyde for 20 minutes at room temperature, permeabilized with 0.1% Triton for 10 minutes, and unspecific labeling was blocked with 1% BSA for 20 minutes. Anti-Myosin MF-20 antibody (1:50) was incubated for 1 hour. After washing by 1% BSA in PBS, rhodamine-conjugated anti-mouse IgG antibody was added diluted 1:500 in 1% BSA and incubated for 1 hour. Nuclei were stained with 1 μg/mL 4,5-diamidino-2-phenylindole (DAPI) for 3 minutes. Cells were examined by immunofluorescence microscopy with an Axiovert 200 microscope, and images acquired using Axiovision 4.1 software (Carl Zeiss, Göttingen, Germany). Differentiated myotubes, but not myoblasts, were evenly labeled on their entire surface. Their area was measured by the method of Sultan et al. 30 , using NIH Image J software. To verify that the various treatments did not induce a cell loss leading to underestimation of myotube area, we evaluated the number of DAPI-stained nuclei in the entire fields, and found no significant loss of nuclei in atrophy-promoting conditions (not shown).

Cells were scraped with 500 μl of ice-cold lysis buffer containing 20 mM Tris–HCl, 100 mM NaCl, 1% Triton and protease inhibitor cocktail (pH 7.6). Lysates were kept on ice during 15 minutes and cleared by centrifugation at 13,000 g for 15 minutes. The creatine kinase activity assay was performed by using a CK – NAC LD B kit from Sobioda (Montbonnot, France), which allows to monitor at 340 nm the kinetics of NADPH formation. The assay was performed in 96-well plates, with 4 μL of sample and 100 μL of reagent per well, for 20 minutes at 30°C.

Cells were scraped in 300 μL ice-cold RIPA buffer, vortexed and centrifuged at 10,000 g for 10 minutes. The assay was carried out in 96-well plates on 50 μL of 1:50 diluted samples. The wells were evaporated to dryness overnight at 37°C and washed twice with cold PBS, using an automatic plate washer (ELx50 Autostrip Washer from Bio-Tek Instruments, Inc.). Unspecific binding sites were saturated with 100 μL of 0.3% BSA in PBS for 30 minutes at 37°C. Samples were then incubated with 50 μL MF-20 antibody diluted 1:100 in PBS, for 1 hour at 37°C. After a new washing step in 0.2% Tween 20 in PBS, incubation with 50 μL of secondary HRP-conjugated anti-mouse IgG antibody diluted 1:3000 was performed for 1 hour at 37°C. Plates were washed 5 times, 50 μL of TMB substrate (Sigma-Aldrich) were added to each well, and 50 μL 0.5 N H₂SO₄ were added after 5 min to stop color reaction. Optical Density was read at 450 nm. A standard curve was obtained with purified myosin heavy chain.

Cells were lyzed as for CK assay, in the presence of 10 mM sodium pyrophosphate, 10 mM glycerophosphate, 50 mM NaF, 1.5 mM Na₃VO₄. Cell lysates were analyzed by SDS/PAGE, and proteins were transferred onto PVDF membranes blocked with 5% BSA in Tris-buffered saline/0.1% Tween 20, and incubated with appropriate antibodies following manufacturers’ recommendations. Immunoblots were revealed with ECL detection system (Pierce) and quantified with Image J software. SDS-PAGE was performed using 10% polyacrylamide gels for S6K1 and Akt. In the case of PLDs, samples were subjected to SDS-PAGE on 8% polyacrylamide gels, in the presence of 4 M urea.

5 week-old male BALB/c mice were obtained from Charles River France. Animals were housed in the animal facility under standard conditions. Adenovirus encoding PLD1 (10⁹ infectious units in 100 μL PBS) were injected in the right gastrocnemius, the left gastrocnemius being injected with the same amount of control GFP-encoding adenovirus. The animals were sacrificed 10 days post-injection, gastrocnemius muscles were dissected from both hind-limbs, frozen in liquid N₂-cooled isopentane and stored at −80°C for either histological or molecular analyses. Muscle cryo-sections (10 μm) were stained with Hematoxylin-Eosin, and fibre cross sectional areas (at least 300 fibres per muscle) were measured by using NIH Image J software. Alternatively, sections from the PLD1-injected muscles were immuno-labeled for laminin and for HA-tag, to respectively determine fibre outline and detect PLD1-expressing fibres. Fibre CSA was determined as above.

Mice were treated in strict accordance to the guidelines of the Institutional Animal Care and Use Committee and to relevant national and European legislation, throughout the experiments.

Total RNA was isolated from L6 myotubes using Trizol Reagent (Life Technologies, Saint-Aubin, France). 1 μg of total RNA was used for reverse transcription, in the presence of 100 U Superscript II (Life Technologies), random hexamers and oligo dT. Real-time PCR was performed with Fast Start DNA Master Sybr green kit using Rotor-Gene 6000 (Corbett research, Mortlake, Australia). Data were analyzed with LightCycler software (Roche Diagnostics, Meylan, France) and normalized to TATA box binding protein (TBP) housekeeping gene transcripts. Specific sense and antisense primers used for amplification were as follows: rPLD1 sense: GGTCAGAAAGATAACCCAGG, rPLD1 anti-sense: GAAGCGAGACAGCGAAATGG; rPLD2 sense: TTGCTGGCTGTGTGTCTGGC, rPLD2 antisense: GGACCTCCAGAGACACAAAG; hPLD1 sense: AAAGCGTGACAGTGAAATGG, hPLD1 anti-sense: GGCCATCAAGATAGCCAAGG; Atrogin-1 sense: CTCTGCCAGTACCACTTCTC, Atrogin-1 anti-sense: ATGGTCAGTGCCCCTCCAGG; Murf1 sense: TGCATCTCCATGCTGGTGGC, Murf1 anti-sense: CTTCTTCTCGTCCAGGATGG; Foxo3a sense: GAGAGCAGATTTGGCAAAGG, Foxo3a anti-sense: CCTCATCTCCACACAGAACG; TBP sense: TGGTGTGCACAGGAGCCAAG, TBP anti-sense: TTCACATCACAGCTCCCCAC.

The statistical significance of data was assessed by ANOVA and Fisher test, using StatView software.