The clinical presentation of the case has been reported elsewhere 22. Briefly, the patient was born to Algerian consanguineous (first cousins) parents. Mental retardation was observed since the age of 4. Spastic tetraparesis and cerebellar ataxia were noted at age 12, along with visual and hearing deficits. Symptoms progressively worsened and, at age 26, the patient suffered from tetraplegia, dysphagia and dysarthria. Brain MRI showed a striking cortical and subcortical atrophy while there was no noticeable demyelination. Skin lesions and skeletal deformations were absent. Siblings were asymptomatic. Written informed consent was obtained from the patient's father for the studies described below and for publication of the study, according to the protocols approved by the ethics review board of the Toulouse Hospital. Research was performed in compliance with the Declaration of Helsinki.

β-Mannosidase activity in peripheral blood leukocytes, cultured lymphoid cells, plasma and HEK293T cells was assessed using 4-methylumbelliferyl-β-D-mannopyranoside (Sigma, St Quentin Fallavier, France) as previously described 12. Acid β-galactosidase and E. coli β-galactosidase activities were determined using the 4-methylumbelliferyl-β-D-galactopyranoside substrate (Sigma). Briefly, cell lysates were incubated in the presence of 0.4 mg/mL of substrate at acidic (0.1 M sodium acetate buffer, pH 4.5) or neutral (0.1 M Tris/HCl buffer, pH 7.0) pH for determining acid, lysosomal β-galactosidase and E. coli β-galactosidase activities, respectively. For the bacterial enzyme (the activity of which is cation-dependent), assays were performed either in the presence of 4 mM EDTA or 10 mM MgCl₂, and the activity was calculated by subtracting the value obtained in the presence of the chelator from that obtained in the presence of MgCl₂. Protein concentration was determined using the bicinchoninic acid protein assay (Sigma).

Genomic DNA was isolated from peripheral blood leukocytes (Nucleospin II, Macherey-Nagel, Germany). Exons 1 through 17 of the MANBA gene including intron-exon junctions were individually amplified and sequenced in both directions using previously described primers 23. For cDNA analysis, RNA was isolated from Epstein-Barr virus-transformed lymphoid cells (SV Total RNA extraction kit, Promega), reverse-transcribed and amplified using previously reported primers 23. DNA sequencing was performed using an ABI3100 Applied Biosystems automatic sequencer. For restriction enzyme analysis of exon 14, amplicons were incubated with MaeIII or BbvI (Roche Diagnostics, Germany, and New England Biolabs, MA, respectively), and analysed on a 1.8% agarose gel. Exon 14 from 200 control subjects, corresponding to 61 Finnish, 57 Norwegian, 35 North-African, 18 Hondurian, 15 Palestinian, and 14 Polish control individuals (anonymized blood-donors), was PCR-amplified and sequenced in the forward direction as previously described 23. The programs SIFT http://sift.jcvi.org/ and PolyPhen http://genetics.bwh.harvard.edu/pph/ were used for evaluation of the p.Arg641His substitution.

The pCS2-MANBA-WT plasmid was kindly provided by Dr. T. Beccari 24. This construct was used as template for site-directed mutagenesis using the QuickChange Site-Directed Mutagenesis Kit (Stratagene) and primer pairs (Forward primer 5' CTACCGCCGTAGTCACAGCGAGATAGTGG 3' and Reverse primer 5' CCACTATCTCGCTGTGACTACGGCGGTAG 3') to introduce the c.1922G>A mutation and to create the pCS2-MANBA-p.Arg641His expression construct. The recombinant vector was purified (Qiagen Plamid Maxi kit) and the insert sequenced using the following primers: 5' GCAAATGGGCGTTCCATTG 3', 5' ACTGCCCTCCACTTGTGC 3', 5' GTGGATGCTAATATGAATAC 3', 5' CATCACGAAGGTGGTAAC 3', and 5' GACCAACTACCACTTCTTG 3'.

Human embryonic kidney cells (HEK293T) were grown in a humidified 5% CO₂ atmosphere at 37°C in DMEM containing Glutamax (2 mM), penicillin (100 U/ml), streptomycin (100 μg/ml) and 10% heat-inactivated FCS. Cells were transfected using Superfect (Qiagen) with 1 μg of pCMV-LacZ plasmid and 5 μg of either pCS2-MANBA or pCS2-MANBA-p.Arg641His plasmid. After 48 hours incubation, cells were washed with PBS, harvested and cell pellets were frozen at -80°C until use. Cells were lysed in water, and enzyme activities were determined as described above. For Western-blot analyses, cells were lysed in lysis buffer (Cell Signaling) containing 1 mM PMSF and a protease inhibitor cocktail (Complete, Roche).

Cell lysates were separated using a 7.5% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane (Bio-Rad). Proteins were detected using an ECL detection system (Pierce). β-Mannosidase was detected by using a mouse polyclonal antibody (1:1000, Abnova). An anti-β-actin (1:1000, Sigma) was used as a control for protein loading. Goat anti-rabbit and anti-mouse secondary antibodies (1:3000) were from Cell Signaling.

The β-mannosidase enzymatic defect was present both in the patient's cells (i.e., peripheral blood leukocytes and Epstein-Barr virus-transformed lymphoid cells) and plasma (Table 1). Of note, a residual activity of about 7 to 14% was consistently observed in all samples.

These results led us to investigate the β-mannosidase activity in the asymptomatic family members (see pedigree in Figure 1A). Intermediate levels of β-mannosidase activity were found in the peripheral blood leukocytes of both parents, as well as in the youngest brother (II-4) and sister. The remaining brother (II-3) had rather normal β-mannosidase activity (Table 1). Determination of β-mannosidase activity in plasma and Epstein-Barr virus-transformed lymphoid cells of each relative gave concording results.

As we recently reported 22, sequencing of all exons, the corresponding exon-intron junctions and the flanking regions of the MANBA gene showed that the proband was homozygous for the novel mutation c.1922G>A in exon 14. This mutation, which was also found by sequencing the cDNA obtained from the patient's cultured lymphoid cells, caused substitution of arginine 641 by histidine (p.Arg641His). The proband's parents, his sister and his youngest brother (II-4) were all heterozygous for this mutation, in agreement with the intermediate level of β-mannosidase activity observed in their cells or plasma. The remaining brother (II-3), who exhibited a normal β-mannosidase activity level, did not carry the c.1922G>A mutation. The genetic status of the family members was confirmed by restriction enzyme analysis using the BbvI and MaeIII enzymes which cleave the wt and mutant sequence, respectively (Figure 1B). The c.1922G>A mutation was not present among 400 control alleles, and two www-based prediction programs suggested that the p.Arg641His change was pathogenic.

The patient was also homozygous for the sequence variant c.2102C>T (p.Thr701Met) in exon 15 (not shown). This sequence variant is common in the control population (frequency 0.49) and is not associated with beta-mannosidosis 24.

In order to test whether the c.1922G>A mutation could be responsible for the β-mannosidase deficiency in the proband, the wt and mutant enzymes were transiently expressed in HEK293T cells and the resulting enzyme activity was measured. As a control for transfection efficiency, cells were simultaneously transfected with a vector encoding the bacterial β-galactosidase (lacZ). The endogenous, acid lysosomal β-galactosidase activity was also assessed as a reference for enzyme activity.

As illustrated in Figure 2, whereas expression of the wt cDNA sequence led to a considerable increase (about 80-fold) of β-mannosidase activity, transfection of the vector carrying the c.1922G>A mutation resulted in a much lower activity, indicating that this mutation is possibly disease-causing. However, the enzyme activity generated by the mutated cDNA remained significantly higher (about 5.6-fold) than that in untransfected cells. The acid β-galactosidase activity was similar in all the cell samples analysed.

The mutant β-mannosidase expression was also characterized by Western-blotting, both in the patient's lymphoid cells and in transiently transfected HEK293T cells (Figure 3). Both the overexpressed and endogenous mutant protein was detected, showing the same apparent size (about 101 kDa) as the wt enzyme. In HEK293T cells, however, the mutant β-mannosidase was less abundant than the wt, suggesting a possible instability of the mutant protein. A similar conclusion could not be drawn for the endogenous enzyme since its expression in lymphoid cells was very low.