. Aurb-catalytic-domain, CD) were also amplified by PCR using vector Phy22-GST-AurB as a template and the following primers containing the restriction sites 5

A. Gga and C. Tga-c-, 3' (BamHI), 5'GGACAGCTAGCATGTTTTGATTGG3' (NheI) respectively. The resulting PCR fragments were cloned into pGEM-T Easy vector (Promega). The PCR fragments encoding full-length (NheI/NheI fragment) and CD-domain (NheI/BamHI fragment) of

. Dimitrov, These constructs have been previously described in Scrittori et al, p.32, 2005.

E. Nigg, Mitotic kinases as regulators of cell division and its checkpoints, Nature Reviews Molecular Cell Biology, vol.2, issue.1, pp.21-32, 2001.
DOI : 10.1038/35048096

D. Ducat and Y. Zheng, Aurora kinases in spindle assembly and chromosome segregation, Experimental Cell Research, vol.301, issue.1, pp.60-67, 2004.
DOI : 10.1016/j.yexcr.2004.08.016

M. Carmena and W. Earnshaw, The cellular geography of aurora kinases, Nature Reviews Molecular Cell Biology, vol.4, issue.11, pp.842-54, 2003.
DOI : 10.1038/nrm1245

D. Mahadevan, D. Bearss, and H. Vankayalapati, Structure-Based Design of Novel Anti-Cancer Agents TargetingAurora Kinases, Current Medicinal Chemistry-Anti-Cancer Agents, vol.3, issue.1, pp.25-34, 2003.
DOI : 10.2174/1568011033353524

H. Katayama, W. Brinkley, and S. Sen, The Aurora kinases: role in cell transformation and tumorigenesis, Cancer and Metastasis Reviews, vol.22, issue.4, pp.451-64, 2003.
DOI : 10.1023/A:1023789416385

P. Meraldi, R. Honda, and E. Nigg, Aurora kinases link chromosome segregation and cell division to cancer susceptibility, Current Opinion in Genetics & Development, vol.14, issue.1, pp.29-36, 2004.
DOI : 10.1016/j.gde.2003.11.006

F. Clairvoyant, C. Ginther, C. Chan, M. Novotny, D. Slamon et al., A homologue of Drosophila aurora kinase is oncogenic and amplified in human colorectal cancers, Embo J, vol.17, issue.11, pp.3052-65, 1998.

M. Tsai, C. Wiese, K. Cao, O. Martin, P. Donovan et al., A Ran signalling pathway mediated by the mitotic kinase Aurora A in spindle assembly, Nature Cell Biology, vol.36, issue.3, pp.242-250, 2003.
DOI : 10.1016/S0962-8924(99)01658-X
URL : https://hal.archives-ouvertes.fr/inserm-00966479

P. Eyers, E. Erikson, L. Chen, and J. Maller, A Novel Mechanism for Activation of the Protein Kinase Aurora A, Current Biology, vol.13, issue.8, pp.691-698, 2003.
DOI : 10.1016/S0960-9822(03)00166-0

R. Giet, R. Uzbekov, F. Cubizolles, L. Guellec, K. Prigent et al., The Xenopus laevis Aurora-related Protein Kinase pEg2 Associates with and Phosphorylates the Kinesin-related Protein XlEg5, Journal of Biological Chemistry, vol.274, issue.21, pp.15005-15018, 1999.
DOI : 10.1074/jbc.274.21.15005
URL : https://hal.archives-ouvertes.fr/inserm-00966047

C. Walczak and P. Stukenberg, Aurora B phosphorylates centromeric MCAK and regulates its localization and microtubule depolymerization activity, Curr Biol, vol.14, issue.4, pp.273-86, 2004.

J. Caldwell, D. Hunt, R. Lin, M. Smith, and C. Allis, Mitotic phosphorylation of histone H3 is governed by Ipl1/aurora kinase and Glc7/PP1 phosphatase in budding yeast and nematodes, Cell, vol.102, issue.3, pp.279-91, 2000.

A. Guse, M. Mishima, and M. Glotzer, Phosphorylation of ZEN-4/MKLP1 by Aurora B Regulates Completion of Cytokinesis, Current Biology, vol.15, issue.8, pp.778-86, 2005.
DOI : 10.1016/j.cub.2005.03.041

Y. Terada, M. Tatsuka, F. Suzuki, Y. Yasuda, S. Fujita et al., AIM-1: a mammalian midbody-associated protein required for cytokinesis, The EMBO Journal, vol.17, issue.3, pp.667-76, 1998.
DOI : 10.1093/emboj/17.3.667

D. and E. Wc, Borealin: a novel chromosomal passenger required for stability of the bipolar mitotic spindle, J Cell Biol, vol.166, issue.2, pp.179-91, 2004.

X. Li, G. Sakashita, H. Matsuzaki, K. Sugimoto, K. Kimura et al., Direct Association with Inner Centromere Protein (INCENP) Activates the Novel Chromosomal Passenger Protein, Aurora-C, Journal of Biological Chemistry, vol.279, issue.45, pp.47201-47212, 2004.
DOI : 10.1074/jbc.M403029200

F. Suzuki, E. Nigg, W. Earnshaw, W. Brinkley, and S. Sen, Aurora-C kinase is a novel chromosomal passenger protein that can complement Aurora-B kinase function in mitotic cells, Cell Motil Cytoskeleton, vol.59, issue.4, pp.249-63, 2004.

R. Giet, C. Prigent, and . Aurora, Ipl1p-related kinases, a new oncogenic family of mitotic serinethreonine kinases, J Cell Sci, vol.112, pp.3591-601, 1999.
URL : https://hal.archives-ouvertes.fr/inserm-00966175

R. Giet and C. Prigent, The non-catalytic domain of the Xenopus laevis auroraA kinase localises the protein to the centrosome, J Cell Sci, vol.114, pp.2095-104, 2001.
URL : https://hal.archives-ouvertes.fr/inserm-00966199

M. Philippe, C. S. Prigent, J. Labbe, C. Prigent, and T. Lorca, The Xenopus protein kinase pEg2 associates with the centrosome in a cell cycle-dependent manner, binds to the spindle microtubules and is involved in bipolar mitotic spindle assembly APC/Fizzy- Related targets Aurora-A kinase for proteolysis, J Cell Sci EMBO Rep, vol.1113, issue.275, pp.557-72457, 1998.

L. Littlepage and J. Ruderman, Identification of a new APC/C recognition domain, the A box, which is required for the Cdh1-dependent destruction of the kinase Aurora-A during mitotic exit, Genes & Development, vol.16, issue.17
DOI : 10.1101/gad.1007302

S. Kaufmann and W. Earnshaw, Human INCENP colocalizes with the Aurora-B/AIRK2 kinase on chromosomes and is overexpressed in tumour cells, Chromosoma, vol.110, issue.2, pp.65-74, 2001.

S. Stewart and G. Fang, Destruction Box-Dependent Degradation of Aurora B Is Mediated by the Anaphase-Promoting Complex/Cyclosome and Cdh1, Cancer Research, vol.65, issue.19, pp.8730-8735, 2005.
DOI : 10.1158/0008-5472.CAN-05-1500

D. Gerloff and W. Earnshaw, INCENP binds the Aurora-related kinase AIRK2 and is required to target it to chromosomes, the central spindle and cleavage furrow, Curr Biol, vol.10, issue.17, pp.1075-1083, 2000.

L. Scrittori, D. Skoufias, F. Hans, V. Gerson, P. Sassone-corsi et al., A Small C-Terminal Sequence of Aurora B Is Responsible for Localization and Function, Molecular Biology of the Cell, vol.16, issue.1, pp.292-305, 2005.
DOI : 10.1091/mbc.E04-06-0447
URL : https://hal.archives-ouvertes.fr/hal-00187757

S. Dutertre, E. Hamard-peron, J. Cremet, Y. Thomas, and C. Prigent, The Absence of p53 Aggravates Polyploidy and Centrosome Number Abnormality Induced by Aurora-C Overexpression, Cell Cycle, vol.4, issue.12, pp.1783-1790, 2005.
DOI : 10.4161/cc.4.12.2172
URL : https://hal.archives-ouvertes.fr/inserm-00966638

D. Stenoien, S. Sen, M. Mancini, and B. Brinkley, Dynamic association of a tumor amplified kinase, Aurora-A, with the centrosome and mitotic spindle, Cell Motility and the Cytoskeleton, vol.20, issue.2, pp.134-180, 2003.
DOI : 10.1002/cm.10120

R. Giet and D. Glover, Aurora B Kinase Is Required for Histone H3 Phosphorylation and Condensin Recruitment during Chromosome Condensation and to Organize the Central Spindle during Cytokinesis, The Journal of Cell Biology, vol.9, issue.4, pp.669-82, 2001.
DOI : 10.1016/S0925-4773(99)00020-9

J. Schumacher, A. Golden, and P. Donovan, Embryos, The Journal of Cell Biology, vol.111, issue.6, pp.1635-1681, 1998.
DOI : 10.1083/jcb.129.5.1287

R. Honda, R. Korner, and E. Nigg, Exploring the Functional Interactions between Aurora B, INCENP, and Survivin in Mitosis, Molecular Biology of the Cell, vol.14, issue.8, pp.3325-3366, 2003.
DOI : 10.1091/mbc.E02-11-0769

R. Giet, C. Petretti, and C. Prigent, Aurora kinases, aneuploidy and cancer, a coincidence or a real link?, Trends in Cell Biology, vol.15, issue.5, pp.241-50, 2005.
DOI : 10.1016/j.tcb.2005.03.004
URL : https://hal.archives-ouvertes.fr/inserm-00966568

G. Mountzios, E. Terpos, and M. Dimopoulos, Aurora kinases as targets for cancer therapy, Cancer Treatment Reviews, vol.34, issue.2
DOI : 10.1016/j.ctrv.2007.09.005

M. Anizet, B. Huwe, A. Pays, and J. Picard, Characterization of a new cell line, XL2, obtained from Xenopus laevis and determination of optimal culture conditions Comparison of Aurora A and B primary sequence between Xenopus and Human, In Vitro FIGURE LEGENDS Fig, vol.17, issue.1, pp.267-74, 1981.