R. L. Adams and S. R. Wente, Uncovering Nuclear Pore Complexity with Innovation, Cell, vol.152, issue.6, pp.1218-1221, 2013.
DOI : 10.1016/j.cell.2013.02.042
URL : https://doi.org/10.1016/j.cell.2013.02.042

S. Anders, P. T. Pyl, and W. Huber, HTSeq--a Python framework to work with high-throughput sequencing data, Bioinformatics, vol.31, issue.2, pp.166-169, 2015.
DOI : 10.1093/bioinformatics/btu638
URL : https://academic.oup.com/bioinformatics/article-pdf/31/2/166/7000027/btu638.pdf

T. Baubec, A. Finke, M. Scheid, O. Pecinka, and A. , Meristem-specific expression of epigenetic regulators safeguards transposon silencing in Arabidopsis, EMBO reports, vol.15, issue.4, pp.446-452, 2014.
DOI : 10.1002/embr.201337915

S. Bauwens, K. Katsanis, M. Van-montagu, P. Van-oostveldt, and G. Engler, Procedure for whole mount fluorescence in situ hybridization of interphase nuclei on Arabidopsis thaliana, The Plant Journal, vol.6, issue.1, pp.123-131, 1994.
DOI : 10.1046/j.1365-313X.1994.6010123.x

W. A. Bickmore and B. Van-steensel, Genome Architecture: Domain Organization of Interphase Chromosomes, Cell, vol.152, issue.6, pp.1270-1284, 2013.
DOI : 10.1016/j.cell.2013.02.001

C. Bourbousse, I. Mestiri, G. Zabulon, M. Bourge, F. Formiggini et al., Light signaling controls nuclear architecture reorganization during seedling establishment, Proc. Natl. Acad. Sci. USA, pp.2836-2844, 2015.
DOI : 10.1371/journal.pgen.1003437
URL : http://www.pnas.org/content/112/21/E2836.full.pdf

M. Bourdon, J. Pirrello, C. Cheniclet, O. Coriton, M. Bourge et al., Evidence for karyoplasmic homeostasis during endoreduplication and a ploidy-dependent increase in gene transcription during tomato fruit growth, Development, vol.139, issue.20, pp.3817-3826, 2012.
DOI : 10.1242/dev.084053
URL : https://hal.archives-ouvertes.fr/hal-00855581

J. M. Bupp, A. E. Martin, E. S. Stensrud, and S. L. Jaspersen, Telomere anchoring at the nuclear periphery requires the budding yeast Sad1-UNC-84 domain protein Mps3, The Journal of Cell Biology, vol.134, issue.5, pp.845-854, 2007.
DOI : 10.1016/j.tcb.2005.12.006
URL : http://jcb.rupress.org/content/jcb/179/5/845.full.pdf

M. N. Conrad, C. Lee, J. L. Wilkerson, and M. E. Dresser, MPS3 mediates meiotic bouquet formation in Saccharomyces cerevisiae, Proc. Natl. Acad. Sci. USA, pp.8863-8868, 2007.
DOI : 10.1083/jcb.200505020
URL : http://www.pnas.org/content/104/21/8863.full.pdf

M. Crisp, Q. Liu, K. Roux, J. B. Rattner, C. Shanahan et al., Coupling of the nucleus and cytoplasm, The Journal of Cell Biology, vol.115, issue.1, pp.41-53, 2006.
DOI : 10.1242/jcs.01642

J. A. Croft, J. M. Bridger, S. Boyle, P. Perry, P. Teague et al., Differences in the Localization and Morphology of Chromosomes in the Human Nucleus, The Journal of Cell Biology, vol.100, issue.6, pp.1119-1131, 1999.
DOI : 10.1023/A:1018438729203

S. De-nooijer, J. Wellink, B. Mulder, and T. Bisseling, Non-specific interactions are sufficient to explain the position of heterochromatic chromocenters and nucleoli in interphase nuclei, Nucleic Acids Research, vol.37, issue.11, pp.3558-3568, 2009.
DOI : 10.1093/nar/gkp219

T. A. Dittmer, N. J. Stacey, K. Sugimoto-shirasu, and E. J. Richards, LITTLE NUCLEI Genes Affecting Nuclear Morphology in Arabidopsis thaliana, THE PLANT CELL ONLINE, vol.19, issue.9, pp.2793-2803, 2007.
DOI : 10.1105/tpc.107.053231
URL : http://www.plantcell.org/content/plantcell/19/9/2793.full.pdf

Y. Fang and D. L. Spector, Centromere Positioning and Dynamics in Living Arabidopsis Plants, Molecular Biology of the Cell, vol.16, issue.12, pp.5710-5718, 2005.
DOI : 10.1091/mbc.E05-08-0706
URL : http://www.molbiolcell.org/content/16/12/5710.full.pdf

A. Fennell, A. Ferna?ndezferna?ndez-Álvarez, K. Tomita, and J. P. Cooper, Telomeres and centromeres have interchangeable roles in promoting meiotic spindle formation, The Journal of Cell Biology, vol.160, issue.4, pp.415-428, 2015.
DOI : 10.1083/jcb.201207168
URL : http://jcb.rupress.org/content/jcb/208/4/415.full.pdf

P. Fransz, J. H. De-jong, M. Lysak, M. R. Castiglione, and I. Schubert, Interphase chromosomes in Arabidopsis are organized as well defined chromocenters from which euchromatin loops emanate, Proc. Natl. Acad. Sci. USA 99, pp.14584-14589, 2002.
DOI : 10.1016/S0962-8924(97)01034-9
URL : http://www.pnas.org/content/99/22/14584.full.pdf

W. L. Gerlach and J. R. Bedbrook, Cloning and characterization of ribosomal RNA genes from wheat and barley, Nucleic Acids Research, vol.7, issue.7, pp.1869-1885, 1979.
DOI : 10.1093/nar/7.7.1869
URL : https://academic.oup.com/nar/article-pdf/7/7/1869/7056022/7-7-1869.pdf

G. Gerlitz and M. Bustin, The role of chromatin structure in cell migration, Trends in Cell Biology, vol.21, issue.1, pp.6-11, 2011.
DOI : 10.1016/j.tcb.2010.09.002

C. Goto, K. Tamura, Y. Fukao, T. Shimada, and I. Hara-nishimura, The Novel Nuclear Envelope Protein KAKU4 Modulates Nuclear Morphology in Arabidopsis, The Plant Cell, vol.26, issue.5, pp.2143-2155, 2014.
DOI : 10.1105/tpc.113.122168

K. Graumann and D. E. Evans, The plant nuclear envelope in focus: Figure 1, Biochemical Society Transactions, vol.38, issue.1, pp.307-311, 2010.
DOI : 10.1042/BST0380307
URL : http://www.biochemsoctrans.org/content/ppbiost/38/1/307.full.pdf

K. Graumann and D. E. Evans, The nuclear envelope-structure and protein interactions, Ann. Plant Rev, vol.46, pp.19-56, 2013.
DOI : 10.1002/9781118472507.ch2

K. Graumann, J. Runions, and D. E. Evans, Characterization of SUN-domain proteins at the higher plant nuclear envelope, The Plant Journal, vol.136, issue.1, pp.134-144, 2010.
DOI : 10.4161/cc.3.12.1316

K. Graumann, E. Vanrobays, S. Tutois, A. V. Probst, D. E. Evans et al., Characterization of two distinct subfamilies of SUN-domain proteins in Arabidopsis and their interactions with the novel KASH-domain protein AtTIK, Journal of Experimental Botany, vol.65, issue.22, pp.6499-6512, 2014.
DOI : 10.1093/jxb/eru368

S. Grob, M. W. Schmid, and U. Grossniklaus, Hi-C Analysis in Arabidopsis Identifies the KNOT, a Structure with Similarities to the flamenco Locus of Drosophila, Molecular Cell, vol.55, issue.5, pp.678-693, 2014.
DOI : 10.1016/j.molcel.2014.07.009

A. Guarda, F. Bolognese, I. M. Bonapace, and G. Badaracco, Interaction between the inner nuclear membrane lamin B receptor and the heterochromatic methyl binding protein, MeCP2, Experimental Cell Research, vol.315, issue.11, pp.1895-1903, 2009.
DOI : 10.1016/j.yexcr.2009.01.019

L. Guelen, L. Pagie, E. Brasset, W. Meuleman, M. B. Faza et al., Domain organization of human chromosomes revealed by mapping of nuclear lamina interactions, Nature, vol.38, issue.7197, pp.948-951, 2008.
DOI : 10.1091/mbc.8.12.2407

N. Janski, K. Masoud, M. Batzenschlager, E. Herzog, J. Evrard et al., The GCP3-Interacting Proteins GIP1 and GIP2 Are Required for ??-Tubulin Complex Protein Localization, Spindle Integrity, and Chromosomal Stability, The Plant Cell, vol.24, issue.3, pp.1171-1187, 2012.
DOI : 10.1105/tpc.111.094904
URL : https://hal.archives-ouvertes.fr/hal-00855567

N. D. Jordan, J. P. West, A. Bottley, M. Sheikh, and I. Furner, Transcript profiling of the hypomethylated hog1 mutant of Arabidopsis, Plant Molecular Biology, vol.39, issue.1, pp.571-586, 2007.
DOI : 10.1371/journal.pbio.0000067

T. Ketelaar, C. Faivre-moskalenko, J. J. Esseling, N. C. Ruijter, . De et al., Positioning of Nuclei in Arabidopsis Root Hairs, The Plant Cell, vol.14, issue.11, pp.2941-2955, 2002.
DOI : 10.1105/tpc.005892

D. Kim, G. Pertea, C. Trapnell, H. Pimentel, R. Kelley et al., TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions, Genome Biology, vol.14, issue.4, p.36, 2013.
DOI : 10.1186/gb-2009-10-3-r25

B. Landrein and O. Hamant, How mechanical stress controls microtubule behavior and morphogenesis in plants: history, experiments and revisited theories, The Plant Journal, vol.26, issue.Pt 4, pp.324-338, 2013.
DOI : 10.1007/s00344-006-0029-2
URL : http://onlinelibrary.wiley.com/doi/10.1111/tpj.12188/pdf

S. Lê, J. Josse, and F. Husson, FactoMineR: an R package for multivariate analysis, J. Stat. Softw, vol.25, pp.1-18, 2008.

D. L. Levy and R. Heald, Nuclear Size Is Regulated by Importin ?? and Ntf2 in Xenopus, Cell, vol.143, issue.2, pp.288-298, 2010.
DOI : 10.1016/j.cell.2010.09.012
URL : https://doi.org/10.1016/j.cell.2010.09.012

C. Liu and D. Weigel, Chromatin in 3D: progress and prospects for plants, Genome Biology, vol.113, issue.1, 2015.
DOI : 10.1007/s00412-004-0316-2
URL : https://genomebiology.biomedcentral.com/track/pdf/10.1186/s13059-015-0738-6?site=genomebiology.biomedcentral.com

J. M. Martinez-zapater, M. A. Estelle, and C. R. Somerville, A highly repeated DNA sequence in Arabidopsis thaliana, MGG Molecular & General Genetics, vol.11, issue.3, pp.417-423, 1986.
DOI : 10.1007/BF00331018

A. Mattout, D. S. Cabianca, and S. M. Gasser, Chromatin states and nuclear organization in development ??? a view from the nuclear lamina, Genome Biology, vol.45, issue.1, pp.174-189, 2015.
DOI : 10.1016/j.ymeth.2008.06.013

A. Me?jatme?jat and T. Misteli, LINC complexes in health and disease, Nucleus, vol.1, issue.1, pp.40-52, 2010.
DOI : 10.4161/nucl.1.1.10530

J. E. Melaragno, B. Mehrotra, and A. W. Coleman, Relationship between Endopolyploidy and Cell Size in Epidermal Tissue of Arabidopsis, THE PLANT CELL ONLINE, vol.5, issue.11, pp.1661-1668, 1993.
DOI : 10.1105/tpc.5.11.1661

K. Nagaki, P. B. Talbert, C. X. Zhong, R. K. Dawe, S. Henikoff et al., Chromatin immunoprecipitation reveals that the 180-bp satellite repeat is the key functional DNA element of arabidopsis thaliana centromeres, Genetics, vol.163, pp.1221-1225, 2003.

F. R. Neumann and P. Nurse, Nuclear size control in fission yeast, The Journal of Cell Biology, vol.13, issue.4, pp.593-600, 2007.
DOI : 10.1038/nrg1747
URL : http://jcb.rupress.org/content/jcb/179/4/593.full.pdf

Y. Oda and H. Fukuda, Dynamics of Arabidopsis SUN proteins during mitosis and their involvement in nuclear shaping, The Plant Journal, vol.20, issue.4, pp.629-641, 2011.
DOI : 10.1105/tpc.108.059220

J. B. Pawley, Points, Pixels, and Gray Levels: Digitizing Image Data, Handbook of Biological Confocal Microscopy, pp.59-79, 2006.
DOI : 10.1007/978-0-387-45524-2_4

H. Pickersgill, B. Kalverda, E. De-wit, W. Talhout, M. Fornerod et al., Characterization of the Drosophila melanogaster genome at the nuclear lamina, Nature Genetics, vol.108, issue.9, pp.1005-1014, 2006.
DOI : 10.1038/sj.embor.7400441

A. Poulet, I. Arganda-carreras, D. Legland, A. V. Probst, P. Andrey et al., NucleusJ: an ImageJ plugin for quantifying 3D images of interphase nuclei, Bioinformatics, vol.31, issue.7, pp.1144-1146, 2015.
DOI : 10.1093/bioinformatics/btu774
URL : https://academic.oup.com/bioinformatics/article-pdf/31/7/1144/17124501/btu774.pdf

A. Poulet, A. V. Probst, K. Graumann, C. Tatout, and D. Evans, Exploring the evolution of the proteins of the plant nuclear envelope, Nucleus, vol.8, issue.1, 2016.
DOI : 10.1080/19491034.2014.1003512

A. V. Probst, P. F. Fransz, J. Paszkowski, M. Scheid, and O. , Two means of transcriptional reactivation within heterochromatin, The Plant Journal, vol.10, issue.4, pp.743-749, 2003.
DOI : 10.1046/j.1365-313X.2003.01667.x

P. Qian, S. Hou, and G. Guo, Molecular mechanisms controlling pavement cell shape in Arabidopsis leaves, Plant Cell Reports, vol.272, issue.8, pp.1147-1157, 2009.
DOI : 10.1007/s00299-009-0729-8

M. Ruault, D. Meyer, A. Loïodice, I. Taddei, and A. , Clustering heterochromatin: Sir3 promotes telomere clustering independently of silencing in yeast, The Journal of Cell Biology, vol.149, issue.3, pp.417-431, 2011.
DOI : 10.1083/jcb.201008007.dv
URL : https://hal.archives-ouvertes.fr/hal-00631367

T. Saito and J. Toriwaki, New algorithms for euclidean distance transformation of an n-dimensional digitized picture with applications. Pattern Recogn, pp.1551-1565, 1994.

V. Schubert, A. Berr, and A. Meister, Interphase chromatin organisation in Arabidopsis nuclei: constraints versus randomness, Chromosoma, vol.166, issue.Pt 4, pp.369-387, 2012.
DOI : 10.1083/jcb.200404107

D. K. Shumaker, T. Dechat, A. Kohlmaier, S. A. Adam, M. R. Bozovsky et al., Mutant nuclear lamin A leads to progressive alterations of epigenetic control in premature aging, Proc. Natl. Acad. Sci. USA 103, pp.8703-8708, 2006.
DOI : 10.1177/002215549704501201

L. Simon, M. Voisin, C. Tatout, and A. V. Probst, Structure and Function of Centromeric and Pericentromeric Heterochromatin in Arabidopsis thaliana, Frontiers in Plant Science, vol.111, pp.1049-1057, 2015.
DOI : 10.1105/tpc.107.057083

W. J. Soppe, S. E. Jacobsen, C. Alonso-blanco, J. P. Jackson, T. Kakutani et al., The Late Flowering Phenotype of fwa Mutants Is Caused by Gain-of-Function Epigenetic Alleles of a Homeodomain Gene, Molecular Cell, vol.6, issue.4, pp.791-802, 2000.
DOI : 10.1016/S1097-2765(05)00090-0

A. Steimer, P. Amedeo, K. Afsar, P. Fransz, O. M. Scheid et al., Endogenous Targets of Transcriptional Gene Silencing in Arabidopsis, THE PLANT CELL ONLINE, vol.12, issue.7, pp.1165-1178, 2000.
DOI : 10.1105/tpc.12.7.1165

K. Sugimoto-shirasu and K. Roberts, ???Big it up???: endoreduplication and cell-size control in plants, Current Opinion in Plant Biology, vol.6, issue.6, pp.544-553, 2003.
DOI : 10.1016/j.pbi.2003.09.009

K. Sugimoto-shirasu, G. R. Roberts, N. J. Stacey, M. C. Mccann, A. Maxwell et al., RHL1 is an essential component of the plant DNA topoisomerase VI complex and is required for ploidy-dependent cell growth, Proc. Natl. Acad. Sci. USA, pp.18736-18741, 2005.
DOI : 10.1093/nar/25.15.3135

K. Tamura and I. Hara-nishimura, Involvement of the nuclear pore complex in morphology of the plant nucleus, Nucleus, vol.2, issue.3, pp.168-172, 2011.
DOI : 10.1073/pnas.0402943101

S. Tashiro and C. Lancto?-t, The International Nucleome Consortium, Nucleus, vol.6, issue.2, pp.89-92, 2015.
DOI : 10.1126/science.1237150
URL : http://www.tandfonline.com/doi/pdf/10.1080/19491034.2015.1022703?needAccess=true

F. Tessadori, M. Chupeau, Y. Chupeau, M. Knip, S. Germann et al., Large-scale dissociation and sequential reassembly of pericentric heterochromatin in dedifferentiated Arabidopsis cells, Journal of Cell Science, vol.120, issue.7, pp.1200-1208, 2007.
DOI : 10.1242/jcs.000026

F. Tessadori, R. K. Schulkes, R. Driel, . Van, and P. Fransz, Light-regulated large-scale reorganization of chromatin during the floral transition in Arabidopsis, The Plant Journal, vol.27, issue.Suppl., pp.848-857, 2007.
DOI : 10.1111/j.1365-313X.2007.03093.x

F. Tessadori, M. Van-zanten, P. Pavlova, R. Clifton, F. Pontvianne et al., PHYTOCHROME B and HISTONE DEACETYLASE 6 Control Light-Induced Chromatin Compaction in Arabidopsis thaliana, PLoS Genetics, vol.112, issue.5, 2009.
DOI : 10.1371/journal.pgen.1000638.s010
URL : http://doi.org/10.1371/journal.pgen.1000638

R. The and . Team, R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing Version 3, 2015.

H. L. Thompson, R. Schmidt, and C. Dean, Identification and distribution of seven classes of middle-repetitive DNA in the Arabidopsis thaliana genome, Nucleic Acids Research, vol.24, issue.15, pp.3017-3022, 1996.
DOI : 10.1093/nar/24.15.3017

J. Traas, ?. Hu, M. Lskamp, E. Gendreau, and H. Ho?-fte, Endoreduplication and development: rule without dividing?, Current Opinion in Plant Biology, vol.1, issue.6, pp.498-503, 1998.
DOI : 10.1016/S1369-5266(98)80042-3

I. Vaillant, S. Tutois, Z. Jasencakova, J. Douet, I. Schubert et al., Hypomethylation and hypermethylation of the tandem repetitive 5S??rRNA genes in Arabidopsis, The Plant Journal, vol.95, issue.2, pp.299-309, 2008.
DOI : 10.1186/gb-2004-5-12-249

M. Van-zanten, M. A. Koini, R. Geyer, Y. Liu, V. Brambilla et al., Seed maturation in Arabidopsis thaliana is characterized by nuclear size reduction and increased chromatin condensation, Proc. Natl. Acad. Sci. USA, pp.20219-20224, 2011.
DOI : 10.1105/tpc.111.084103

H. Wang, T. A. Dittmer, and E. J. Richards, Arabidopsis CROWDED NUCLEI (CRWN) proteins are required for nuclear size control and heterochromatin organization, BMC Plant Biology, vol.13, issue.1, 0200.
DOI : 10.1007/BF02672073
URL : https://bmcplantbiol.biomedcentral.com/track/pdf/10.1186/1471-2229-13-200?site=bmcplantbiol.biomedcentral.com

M. Webster, K. L. Witkin, and O. Cohen-fix, Sizing up the nucleus: nuclear shape, size and nuclear-envelope assembly, Journal of Cell Science, vol.122, issue.10, pp.1477-1486, 2009.
DOI : 10.1242/jcs.037333
URL : http://jcs.biologists.org/content/joces/122/10/1477.full.pdf

H. Xiong, F. Rivero, U. Euteneuer, S. Mondal, S. Mana-capelli et al., Dictyostelium Sun-1 Connects the Centrosome to Chromatin and Ensures Genome Stability, Traffic, vol.96, issue.5, pp.708-724, 2008.
DOI : 10.1083/jcb.128.5.819
URL : http://onlinelibrary.wiley.com/doi/10.1111/j.1600-0854.2008.00721.x/pdf

R. Yelagandula, H. Stroud, S. Holec, K. Zhou, S. Feng et al., The Histone Variant H2A.W Defines Heterochromatin and Promotes Chromatin Condensation in Arabidopsis, Cell, vol.158, issue.1, pp.98-109, 2014.
DOI : 10.1016/j.cell.2014.06.006

X. Zhou and I. Meier, Efficient plant male fertility depends on vegetative nuclear movement mediated by two families of plant outer nuclear membrane proteins, Proc. Natl. Acad. Sci. USA, pp.11900-11905, 2014.
DOI : 10.1105/tpc.2.8.755

X. Zhou, K. Graumann, D. E. Evans, and I. Meier, Novel plant SUN???KASH bridges are involved in RanGAP anchoring and nuclear shape determination, The Journal of Cell Biology, vol.343, issue.2, pp.203-211, 2012.
DOI : 10.1105/tpc.108.059220
URL : http://jcb.rupress.org/content/jcb/196/2/203.full.pdf

X. Zhou, K. Graumann, and I. Meier, The plant nuclear envelope as a multifunctional platform LINCed by SUN and KASH, Journal of Experimental Botany, vol.66, issue.6, pp.1649-1659, 2015.
DOI : 10.1093/jxb/erv082

X. Zhou, N. R. Groves, and I. Meier, Plant nuclear shape is independently determined by the SUN-WIP-WIT2-myosin XI-i complex and CRWN1, Nucleus, vol.6, issue.2, pp.144-153, 2015.
DOI : 10.1046/j.1365-313x.1998.00343.x
URL : http://www.tandfonline.com/doi/pdf/10.1080/19491034.2014.1003512?needAccess=true

J. Sci, 130: doi:10.1242/jcs.194712: Supplementary information Journal of Cell Science ? Supplementary information Table S5: Primers used in this study Purpose Gene FORWARD (F) and REVERSE (R) PRIMERS (5' to 3

T. Tcg, G. Gga, C. Agc-ct380_wit2_wit21425r:-gttgagttcagagtttgtggtaga-lbb1caa, . Cac, . Tag et al., TAGCATCTGAATTTCATAACCAATCTCGATACAC Genotyping of wip2-1 (SALK_052226) At5g56210 CT286_wip2, Genotyping of wit1-1 (GABI-Kat 470E06) At5g11390 CT383_Wit1: TTCTTCCATGTAGACAACATCCTG CT384_Wit1: CACCATGGAAACAGAAACGGAACATGATAGA GK_o8409: ATATTGACCATCATACTCATTGC Genotyping of ATTTTGCCGATTTCGGAAC Genotyping of wip1-1 (SAIL_390_A08) At4g26455 CT425_SAIL390_A08_Wip1-1_LB:: TAGCAGTATCATGACCCAGCC CT140_SALK126070_RP: GTCAGGGAGTCTGAGTTTCCC LBb1.3: ATTTTGCCGATTTCGGAAC Genotyping of SALK_025347) At1g67230 CT_Linc1_N525347_LP_11: GCAACTTTGTCAAAGCAGAGG CT_Linc1_N525347_RP_12: AGTTTCCAATGCCTTCTCCTC LBb1, pp.2-3, 23383.